View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_high_25 (Length: 208)
Name: NF0683_high_25
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0683_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 3 - 115
Target Start/End: Original strand, 48153529 - 48153641
Alignment:
| Q |
3 |
aggaggagcagagaagagaagatagatgtaaaaacataaaagaaatagaatccttagaaatctcacgatatgaagaaagctccgaagcctcgatacttca |
102 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||| | |
|
|
| T |
48153529 |
aggagaagcagagaagagaagatagatgtaaaaacataaaagaaatagaatccttagaaatctcacgatatgaagaaagctctgaagacttgatacttta |
48153628 |
T |
 |
| Q |
103 |
aaatagatgatgt |
115 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
48153629 |
aaatggatgatgt |
48153641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University