View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_27 (Length: 331)
Name: NF0683_low_27
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0683_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 136 - 237
Target Start/End: Complemental strand, 22467868 - 22467767
Alignment:
Q |
136 |
gaactccagaagatgaaactaactcactctactcttgtgtgttttcctgaaatgaacaagttaccgttttgttgaaacgaggttgcaattttgtgttgtt |
235 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22467868 |
gaactccagaagatgaaactaactcactctactcttgtgtgttttcatgaaatgaacaagttaccgttttgttgaaacgaggttgcaattttgtgttgtt |
22467769 |
T |
 |
Q |
236 |
gg |
237 |
Q |
|
|
|| |
|
|
T |
22467768 |
gg |
22467767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University