View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_28 (Length: 330)
Name: NF0683_low_28
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0683_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 29 - 324
Target Start/End: Original strand, 36980936 - 36981231
Alignment:
| Q |
29 |
atttgatgtagcaaacaagattgggatcatctaagttagtacctcgttttgattagttattatttagttgctagacagttccatgcttatctttaatgga |
128 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||| ||||||||||||||||||||| || |
|
|
| T |
36980936 |
atttgatgtagcaaataagattgggatcatctaagttagtacctcatcttgattagttattatttagttgatagatagttccatgcttatctttaataga |
36981035 |
T |
 |
| Q |
129 |
aacttttggaaaacgggtaagtttttatattttgttctttgttgttttctacctttctccttttgtgatgagaatacacgagccatatgacctctcttat |
228 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36981036 |
aacttttggaaaacggataagtttttatattttgttctttgttgttttctacctttctccttttgtgatgagaatacacgagccatatgacctctcttat |
36981135 |
T |
 |
| Q |
229 |
tatttgaaagaaaaagttaatttagttgtatatatatggtcaacttataaaggttgtcatttgttttgttgatcagtaagagaagatattcttcga |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
36981136 |
tatttgaaagaaaaaattaatttagttgtatatatatggtcaacttataaaggttgtcgtttgttttgttgatcagtaagagatgatattgttcga |
36981231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 28 - 64
Target Start/End: Original strand, 23321118 - 23321154
Alignment:
| Q |
28 |
catttgatgtagcaaacaagattgggatcatctaagt |
64 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23321118 |
cattggatgtagcaaacaagattgggatcatctaagt |
23321154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University