View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_29 (Length: 323)
Name: NF0683_low_29
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0683_low_29 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 13204914 - 13204992
Alignment:
| Q |
1 |
ttgtttcatgattattaaggctttccttcatgtatgcaattcaaactaatgatgataggagcaaaaatgtgttatattt |
79 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13204914 |
ttgtttcatgattattaaggcttgccttcaagtattcaattcaaactaatgatgataggagcaaaaatgttttatattt |
13204992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 13178837 - 13178968
Alignment:
| Q |
1 |
ttgtttcatgattattaaggctttccttcatgtatgcaattcaaactaatgatgataggagcaaaaatgtgttatatttttaatannnnnnnnatatact |
100 |
Q |
| |
|
||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| || ||||| ||||||| ||||||| |
|
|
| T |
13178837 |
ttgtttcgtgattattaaggcttgtcctcatgtatgcaattcaaactaatgatgataggagcaaaaaagttttata--tttaata--ttttgaatatact |
13178932 |
T |
 |
| Q |
101 |
ataagagtttgttgtagattgaatccggggaacatg |
136 |
Q |
| |
|
||| |||||||||||||||||||| |||||||||| |
|
|
| T |
13178933 |
ataggagtttgttgtagattgaattaggggaacatg |
13178968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 72
Target Start/End: Original strand, 154202 - 154248
Alignment:
| Q |
26 |
cttcatgtatgcaattcaaactaatgatgataggagcaaaaatgtgt |
72 |
Q |
| |
|
|||||||||| |||||||||||||||||| || ||||||||||||| |
|
|
| T |
154202 |
cttcatgtatataattcaaactaatgatgacagaagcaaaaatgtgt |
154248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University