View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0683_low_32 (Length: 318)

Name: NF0683_low_32
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0683_low_32
NF0683_low_32
[»] chr2 (2 HSPs)
chr2 (38-216)||(7535091-7535269)
chr2 (56-216)||(7449553-7449713)
[»] chr5 (2 HSPs)
chr5 (60-215)||(18664543-18664698)
chr5 (103-213)||(18664845-18664955)
[»] chr1 (2 HSPs)
chr1 (60-215)||(15079130-15079285)
chr1 (103-215)||(15078873-15078985)


Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 38 - 216
Target Start/End: Complemental strand, 7535269 - 7535091
Alignment:
38 aggcacactcgtagaagtactagatagtttttgcagggatggtaaagtgaatgaatcggttgacattttgcaagtgttggaaaagctttatattcatatg 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
7535269 aggcacactcgtagaagtactagatagtttttgcagggatggtaaagtgaatgaagcggttgacattttgcaagtgttggaaaagctttatattcatatg 7535170  T
138 gatttgcagcgttgtttgcaattaatgcacgtttgtgggaagactaagtctcttgaagaggcaagagttgtacacagac 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7535169 gatttgcagcgttgtttgcaattaatgcacgtttgtgggaagactaagtctcttgaagaggcaagagttgtacacagac 7535091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 56 - 216
Target Start/End: Complemental strand, 7449713 - 7449553
Alignment:
56 actagatagtttttgcagggatggtaaagtgaatgaatcggttgacattttgcaagtgttggaaaagctttatattcatatggatttgcagcgttgtttg 155  Q
    ||||||||||||||||||||||||||||||||| ||| | ||||| | |||||||  ||||||||||||| |||||||| ||||||||||||||||||||    
7449713 actagatagtttttgcagggatggtaaagtgaaggaagcagttgaaaatttgcaaaagttggaaaagcttcatattcatgtggatttgcagcgttgtttg 7449614  T
156 caattaatgcacgtttgtgggaagactaagtctcttgaagaggcaagagttgtacacagac 216  Q
    |||||||||| | ||||||||||| ||||||||||||| ||||||||||||||||||||||    
7449613 caattaatgcgcatttgtgggaaggctaagtctcttgaggaggcaagagttgtacacagac 7449553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 60 - 215
Target Start/End: Complemental strand, 18664698 - 18664543
Alignment:
60 gatagtttttgcagggatggtaaagtgaatgaatcggttgacattttgcaagtgttggaaaagctttatattcatatggatttgcagcgttgtttgcaat 159  Q
    ||||||| ||||| ||| ||| ||||||| ||| |  ||||  ||||||||||||| |||||| || |||||| | | |||||| | |||||||||| ||    
18664698 gatagttcttgcatggagggtgaagtgaaggaagcaattgatgttttgcaagtgttagaaaagtttcatattcttgtagatttggatcgttgtttgcgat 18664599  T
160 taatgcacgtttgtgggaagactaagtctcttgaagaggcaagagttgtacacaga 215  Q
    |||||||    ||||||||||| ||||||||||||||||||| |||||||||||||    
18664598 taatgcaacaatgtgggaagaccaagtctcttgaagaggcaaaagttgtacacaga 18664543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 103 - 213
Target Start/End: Complemental strand, 18664955 - 18664845
Alignment:
103 ttttgcaagtgttggaaaagctttatattcatatggatttgcagcgttgtttgcaattaatgcacgtttgtgggaagactaagtctcttgaagaggcaag 202  Q
    ||||||||| ||| ||||||||| ||| | || |||||||| | | |||||||| |||||||||  | ||||| ||| || ||| ||||||||||||||     
18664955 ttttgcaagagttagaaaagcttcatacttatgtggatttgtatctttgtttgcgattaatgcaactgtgtggaaaggctgagtttcttgaagaggcaaa 18664856  T
203 agttgtacaca 213  Q
    |||||||||||    
18664855 agttgtacaca 18664845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 60 - 215
Target Start/End: Original strand, 15079130 - 15079285
Alignment:
60 gatagtttttgcagggatggtaaagtgaatgaatcggttgacattttgcaagtgttggaaaagctttatattcatatggatttgcagcgttgtttgcaat 159  Q
    ||||||| ||||| ||| ||| ||||||| ||| |  ||||  ||||||||||||| |||||| || |||||||| | |||||| | |||||||||  ||    
15079130 gatagttcttgcatggagggtgaagtgaaggaagcaattgatgttttgcaagtgttagaaaagtttcatattcatgtagatttggatcgttgtttgagat 15079229  T
160 taatgcacgtttgtgggaagactaagtctcttgaagaggcaagagttgtacacaga 215  Q
    |||||||    ||||||||||| ||||||||||||||||||| |||||||||||||    
15079230 taatgcaacaatgtgggaagaccaagtctcttgaagaggcaaaagttgtacacaga 15079285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 103 - 215
Target Start/End: Original strand, 15078873 - 15078985
Alignment:
103 ttttgcaagtgttggaaaagctttatattcatatggatttgcagcgttgtttgcaattaatgcacgtttgtgggaagactaagtctcttgaagaggcaag 202  Q
    ||||||||| ||| ||||||||| ||| | || |||||||| | | |||||||| |||||||||  | ||||| ||| || ||| ||||||||||||||     
15078873 ttttgcaagagttagaaaagcttcatacttatgtggatttgtatctttgtttgcgattaatgcaactgtgtggaaaggctgagtttcttgaagaggcaaa 15078972  T
203 agttgtacacaga 215  Q
    |||||||||||||    
15078973 agttgtacacaga 15078985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1274 times since January 2019
Visitors: 4365