View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_33 (Length: 307)
Name: NF0683_low_33
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0683_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 65 - 231
Target Start/End: Original strand, 35901330 - 35901496
Alignment:
Q |
65 |
tgatatgaattggaattgtatctagacctgtaattgctttctagcccttggttgcaactctgtgtctgaggaagacttggaccatagaagtttctcagag |
164 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35901330 |
tgatttgaattggaattgtatctagacctgtaattgctttctagccctttgttgcaactctgtgtctgaggaagacttggaccatagaagtttctcagag |
35901429 |
T |
 |
Q |
165 |
ggacttggctatctgcattggcaagtgatagagtggtgagttttctctttcgttgggcatgatgatg |
231 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35901430 |
ggacttggctatctgcattggcaagtgatagagtggtgagttttctctttcgttgggcatgatgatg |
35901496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 65 - 231
Target Start/End: Original strand, 17477608 - 17477774
Alignment:
Q |
65 |
tgatatgaattggaattgtatctagacctgtaattgctttctagcccttggttgcaactctgtgtctgaggaagacttggaccatagaagtttctcagag |
164 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
17477608 |
tgatttgaattggaattgtatctagacctgtaattgctttctagccctttgttgcaactctgtgtatgaggaagacttggaccatagaagtttctcagag |
17477707 |
T |
 |
Q |
165 |
ggacttggctatctgcattggcaagtgatagagtggtgagttttctctttcgttgggcatgatgatg |
231 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
17477708 |
ggacttggctatctgcattggcaagtgatagagtggtgagttttctcttttgttgggcatgatgatg |
17477774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1058 times since January 2019
Visitors: 4363