View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_37 (Length: 295)
Name: NF0683_low_37
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0683_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 59 - 257
Target Start/End: Complemental strand, 55397208 - 55397010
Alignment:
Q |
59 |
caacaatatccaattcctctcatcacactcttctccgtctctattccccctcccttcctcaaaattcagcaccgttccttttcccacaccaatcagaaga |
158 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55397208 |
caacaatgtccaattcctctcatcacactcttctccgtctctattccccctcccttcctcaaaattcagcaccgttccttttcccacaccaatcagaaga |
55397109 |
T |
 |
Q |
159 |
agaacctccttttctactctcagattccgtagtttcactcgcagactcagaaactcgtcgacgaatgatgttaaactgaacgaaacggagcagaagaag |
257 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
55397108 |
agaacctccttttctactctcagattccgtagtttcactcgcagactcagaaactcgtcgacgaatgatgttcaactgaacgaaacggagcagaagaag |
55397010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University