View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_39 (Length: 287)
Name: NF0683_low_39
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0683_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 97 - 210
Target Start/End: Original strand, 46263629 - 46263742
Alignment:
| Q |
97 |
aaagtgacatgtgtaaaacacaattataacaagagcatacactggtccaaagaaatatcaattgaatcagtttgatcgttcctaaagataccattttgct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46263629 |
aaagtgacatgtgtaaaacacaattataacaagagcatacactggtccaaagaaatatcaattgaatcagtttgatcgttcctaaagataccattttgct |
46263728 |
T |
|
| Q |
197 |
ccgtcccgttggca |
210 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
46263729 |
ccatcccgttggca |
46263742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1125 times since January 2019
Visitors: 4365