View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_41 (Length: 269)
Name: NF0683_low_41
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0683_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 26 - 227
Target Start/End: Original strand, 39194686 - 39194887
Alignment:
Q |
26 |
cataggcaagagggttacatatataaactttggaaagtctgtatgtattttaacgaacatgtgagtgagggcccaaaagctggttcttgcctttatacta |
125 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39194686 |
cataggcaagagggttacatatataaactttggaaagtctgtatgtattttaacgaacatgtgagtgagggcccaaaagctggttcttgcctttatacta |
39194785 |
T |
 |
Q |
126 |
cgtttgtttgtggttgctatccctttcaactttcatgccttaactttttagggtcatctatcttaatttctgtacaaagctgcatcttgactctgcttca |
225 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39194786 |
cgtttgtttgtggttgctatctctttcaactttcatgccttaactttttagggtcatctatcttaatttctgtacaaagctgcatcttgactctgcttca |
39194885 |
T |
 |
Q |
226 |
tg |
227 |
Q |
|
|
|| |
|
|
T |
39194886 |
tg |
39194887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University