View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_45 (Length: 254)
Name: NF0683_low_45
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0683_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 74 - 220
Target Start/End: Complemental strand, 46630978 - 46630832
Alignment:
| Q |
74 |
tagctgttgctgatgatcttctaaaactccatctcttcttctcctttgagggtgttgttgaaacaggagtagttggattttctgttccatttgaaaaatt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46630978 |
tagctgttgctgatgatcttctaaaactccatctcttcttctcctttgagggtgttgttgaaacaggagtagttggattttctgttccatttgaaaaatt |
46630879 |
T |
|
| Q |
174 |
ctggtttgtgttacatttttccttctctttttctttgtccttcttcc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46630878 |
ctggtttgtgttacatttttccttctctttttctttgtccttcttcc |
46630832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 82 - 165
Target Start/End: Complemental strand, 15505201 - 15505121
Alignment:
| Q |
82 |
gctgatgatcttctaaaactccatctcttcttctcctttgagggtgttgttgaaacaggagtagttggattttctgttccattt |
165 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||||||| ||||||||||| | |||||||| |||||||| ||||||||| |
|
|
| T |
15505201 |
gctgatgatcttctgaaactccatcttcttttctccttt---ggtgttgttgagattggagtagtaggattttcagttccattt |
15505121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 23 - 69
Target Start/End: Complemental strand, 4224436 - 4224390
Alignment:
| Q |
23 |
ctccaacaaaatcacccctaacccataaacatcattttccttacaaa |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4224436 |
ctccaacaaaatcacccctaacccataaacatcattttccttacaaa |
4224390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1418 times since January 2019
Visitors: 4416