View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_47 (Length: 249)
Name: NF0683_low_47
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0683_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 29 - 239
Target Start/End: Complemental strand, 35710052 - 35709839
Alignment:
| Q |
29 |
gtgaaataatgttccatctgttgttccttt------tcattcaagtgtttttaattatgtattttggcttattgttgtacgctgcgttgtcatttttgtt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35710052 |
gtgaaataatgttccatctgttgttcctttcaagcttaagtcaagtgtttttaattatgtattttggcttattgttgtacgctgcgttgtcatttttgtt |
35709953 |
T |
|
| Q |
123 |
gtcgcaagcttagctgtctaatgatgtgggcaattcgaaccaagaccttattcaatcccaatgctgnnnnnnnnnngttatatcatggtcaacagttcta |
222 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35709952 |
gtcgcaaacttagctgtctaatgatatgggcaattcgaaccaagaccttattcaatcccaatgctg--tttttttcgttatatcatggtcaacagttcta |
35709855 |
T |
|
| Q |
223 |
tatattattatcctttg |
239 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
35709854 |
tatatta-tatcctttg |
35709839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1144 times since January 2019
Visitors: 4407