View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_53 (Length: 216)
Name: NF0683_low_53
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0683_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 24278657 - 24278573
Alignment:
Q |
1 |
tttcaaacatttgagttattgggtctcttgagttagtggtgcnnnnnnnntcaagggcttttaattacaaaatacatgaatatat |
85 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
T |
24278657 |
tttcaaacatttgagttattgggtctcttgagttagtggtgcaaaaaaaatcaagggcttttaaatacaaaatacatgaatatat |
24278573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 697 times since January 2019
Visitors: 4390