View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_55 (Length: 215)
Name: NF0683_low_55
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0683_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 24278657 - 24278573
Alignment:
Q |
1 |
tttcaaacatttgagttattgggtctcttgagttagtggtgc-nnnnnnntcaagggcttttaattacaaaatacatgaatatat |
84 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
T |
24278657 |
tttcaaacatttgagttattgggtctcttgagttagtggtgcaaaaaaaatcaagggcttttaaatacaaaatacatgaatatat |
24278573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University