View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0683_low_56 (Length: 212)

Name: NF0683_low_56
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0683_low_56
NF0683_low_56
[»] chr6 (1 HSPs)
chr6 (1-131)||(5599624-5599754)


Alignment Details
Target: chr6 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 5599624 - 5599754
Alignment:
1 ttattttcccttaataattgcagttgcaattgggtatctctctcttctatctaatatttatacttatagggttgcacatgtgcacacgtgcacacgtggg 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5599624 ttattttcccttaataattgcaattgcaattgggtatctctctcttctatctaatatttatacttatagggttgcacatgtgcacacgtgcacacgtggg 5599723  T
101 tgactatgtcacaactatttaagttgaagga 131  Q
    |||||||||||||||||||||||||||||||    
5599724 tgactatgtcacaactatttaagttgaagga 5599754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1467 times since January 2019
Visitors: 4416