View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0683_low_58 (Length: 208)

Name: NF0683_low_58
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0683_low_58
NF0683_low_58
[»] chr7 (1 HSPs)
chr7 (3-115)||(48153529-48153641)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 3 - 115
Target Start/End: Original strand, 48153529 - 48153641
Alignment:
3 aggaggagcagagaagagaagatagatgtaaaaacataaaagaaatagaatccttagaaatctcacgatatgaagaaagctccgaagcctcgatacttca 102  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||| |    
48153529 aggagaagcagagaagagaagatagatgtaaaaacataaaagaaatagaatccttagaaatctcacgatatgaagaaagctctgaagacttgatacttta 48153628  T
103 aaatagatgatgt 115  Q
    |||| ||||||||    
48153629 aaatggatgatgt 48153641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University