View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_59 (Length: 206)
Name: NF0683_low_59
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0683_low_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 33157837 - 33158013
Alignment:
Q |
1 |
aagtatcacacacgtgaaataaattgctgtaaacaatatccagtgtgaaagagattgttgaccaagaaaatcatgatctatgtaccgtatattcttctat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
33157837 |
aagtatcacacacgtgaaataaattgctgtaaacaatatccagtgtgaaagagattgttgaccaagcaaatcatgatctatgtaccgtatattcttctat |
33157936 |
T |
 |
Q |
101 |
acacattttaaattcaatctccaaaatttgttgctatgttcttttgactggccaaattttgttgctattgttgattg |
177 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33157937 |
acacattttaaattcaatctccaaaatttgttgctatgttcttttgactggccaaattttgttgctattgttgattg |
33158013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1281 times since January 2019
Visitors: 4365