View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0683_low_62 (Length: 202)
Name: NF0683_low_62
Description: NF0683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0683_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 41820316 - 41820421
Alignment:
| Q |
1 |
aaggttgctatgctcctttgcctcaacatcatatttttcactgtggtaagctccacatatgttccatgtcccccaccacctcacaaagatcacggccact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41820316 |
aaggttgctatgctcctttgcctcaacatcatatttttcactgtggtaagctccacatatgttccatgtcccccaccacctcacaaagatcacggccact |
41820415 |
T |
 |
| Q |
101 |
cgcacc |
106 |
Q |
| |
|
| |||| |
|
|
| T |
41820416 |
cacacc |
41820421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 44829986 - 44829888
Alignment:
| Q |
1 |
aaggttgctatgctcctttgcctcaacatcatatttttcactgtggtaagctccacatatgttccatgtcccccaccacctcacaaagatcacggccac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44829986 |
aaggttgctatgctcctttgcctcaacatcctatttttcactgtggtaagctcaacatatgttccatgtcccccaccacctcacaaagatcacagccac |
44829888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University