View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_high_11 (Length: 444)
Name: NF0684_high_11
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0684_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 2e-99; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 29 - 255
Target Start/End: Complemental strand, 33581154 - 33580930
Alignment:
Q |
29 |
actcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcagtctccgccttagaatgtggatatgcctgtgctgctgaagtacactaccc |
128 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33581154 |
actcacagcttgcaaaggctttgtcaattgaaggagactaccgaggttaagtctccgccttagaatgtggatatgcctgtgctgctgaagtacactaccc |
33581055 |
T |
 |
Q |
129 |
agatttgcaggttagttttgaaaggttacaagaaaagacatctcctttaatctctcttctctgctctttgcatctgattcattagttcacttaattctta |
228 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
33581054 |
agatttgcaggttagttttgaaaggtttcaagaaaagacatctccttt--gctcccttctctgctctttgcatccgattcattagttcacttaattctta |
33580957 |
T |
 |
Q |
229 |
caattaattggtagaaccttctggaag |
255 |
Q |
|
|
||| ||||||||||||||||||||||| |
|
|
T |
33580956 |
caactaattggtagaaccttctggaag |
33580930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 29 - 255
Target Start/End: Complemental strand, 32356462 - 32356238
Alignment:
Q |
29 |
actcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcagtctccgccttagaatgtggatatgcctgtgctgctgaagtacactaccc |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
T |
32356462 |
actcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcaatctccgccttagaatgtggatatgcctgtgctactgaagtacgctaccc |
32356363 |
T |
 |
Q |
129 |
agatttgcaggttagttttgaaaggttacaagaaaagacatctcctttaatctctcttctctgctctttgcatctgattcattagttcacttaattctta |
228 |
Q |
|
|
||| |||||||||||| ||||||| |||||||||||||||||||||| ||| ||||| | ||||||||||| |||||||||||| |||||||||||| |
|
|
T |
32356362 |
agagttgcaggttagtagtgaaaggctacaagaaaagacatctccttt--gctcccttctttactctttgcatccgattcattagtttacttaattctta |
32356265 |
T |
 |
Q |
229 |
caattaattggtagaaccttctggaag |
255 |
Q |
|
|
||| |||| ||||||||||||||||| |
|
|
T |
32356264 |
caactaatacgtagaaccttctggaag |
32356238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 352 - 440
Target Start/End: Complemental strand, 33580832 - 33580744
Alignment:
Q |
352 |
ccctttcttctttccttcccttaatcttaactcatcactttcatcttttatacctgcttctattatgacaattttacttcatctcactc |
440 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
T |
33580832 |
ccctttcttctttccttcccttattcttaactcatcactttcatcttttatacctgcttctattatgacaattttacttcttttcactc |
33580744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 429
Target Start/End: Complemental strand, 32356106 - 32356060
Alignment:
Q |
383 |
tcatcactttcatcttttatacctgcttctattatgacaattttact |
429 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
32356106 |
tcatcactttcatcttttataccagcttctattatgacaattttact |
32356060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 8e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 29 - 145
Target Start/End: Complemental strand, 17922397 - 17922281
Alignment:
Q |
29 |
actcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcagtctccgccttagaatgtggatatgcctgtgctgctgaagtacactaccc |
128 |
Q |
|
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||| ||||| ||||||||| ||||||| | |||||| |||||| |
|
|
T |
17922397 |
actcacagcttgcaaatgctctgtcaactgaaggagactaccggggttcagtctcggccatagaacgtggatatgtctgtgctagtaaagtaccctaccc |
17922298 |
T |
 |
Q |
129 |
agatttgcaggttagtt |
145 |
Q |
|
|
||| |||||||||||| |
|
|
T |
17922297 |
agagatgcaggttagtt |
17922281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 362 - 430
Target Start/End: Complemental strand, 17969315 - 17969247
Alignment:
Q |
362 |
tttccttcccttaatcttaactcatcactttcatcttttatacctgcttctattatgacaattttactt |
430 |
Q |
|
|
||||||| |||| |||| |||| ||||||||||||||||||| | ||||||||| ||||||| ||||| |
|
|
T |
17969315 |
tttccttatcttattctttactcgtcactttcatcttttatacgttcttctattacgacaattctactt |
17969247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 58 - 145
Target Start/End: Complemental strand, 8024690 - 8024603
Alignment:
Q |
58 |
gaaggagactaccggggttcagtctccgccttagaatgtggatatgcctgtgctgctgaagtacactacccagatttgcaggttagtt |
145 |
Q |
|
|
||||||||||||| |||||||||||| ||||||||| ||||||||| ||||||| || |||||| ||||||||| ||||||||||||| |
|
|
T |
8024690 |
gaaggagactaccagggttcagtctcggccttagaacgtggatatgtctgtgctactaaagtaccctacccagagttgcaggttagtt |
8024603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University