View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_high_35 (Length: 307)
Name: NF0684_high_35
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_high_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 10412680 - 10412964
Alignment:
| Q |
1 |
aaatgagtcattcattttgacgcaaagaagtatttaggcagccataagagtacaaacacttacctaacaattagaatcaatttgtcttacttaatagagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10412680 |
aaatgagtcattcattttgacgcaaagaagtatttaggtagccataagagtacaaacacttacctaacaattagaatcaatttgtcttacttaatagagt |
10412779 |
T |
|
| Q |
101 |
cttaatgattgatattaccaaccaagttgtaccacatacattagagtatagcttgtcaatctgggtctgtctgtactggctgtggtactatatatctatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10412780 |
cttaatgattgatattaccaaccaagttgtaccacatacattagagtatagcttgtcaatctgggtctgtctgtactggctgtggtactagatatctatg |
10412879 |
T |
|
| Q |
201 |
ttcatgaacttggcagattcgagggccaactatatgtttcatttgatggcattgcc-tttttatttattgtatatgaaatgatgatg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10412880 |
ttcatgaacttggcagattcgagggccaac--tatgtttcatttgatggcattgccttttttatttattgtatatgaaatgatgatg |
10412964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1790 times since January 2019
Visitors: 4432