View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_high_40 (Length: 291)
Name: NF0684_high_40
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 25 - 282
Target Start/End: Complemental strand, 5754611 - 5754360
Alignment:
| Q |
25 |
aaaaacaatataaataatattttattcaagatgtctccatatccgtcctaataccccatgatattttcttctgccatcgatgattggaatttgaaactaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5754611 |
aaaaacaatataaataatattttattcaagatgtttccatatccgtcctaataccccatgatattttcttctgc-------gattggaatttgaaactaa |
5754519 |
T |
 |
| Q |
125 |
gtttatccc-aacgattatatatctccttttactatgtgtatatatccaaatcaccattaatgttttttggtcaagaaaaaacaccatttatgttaactg |
223 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5754518 |
gtttacccccaacgattatatatctccttttactatgtgtatatatccaaatcaccattaatgttttttggtcaagaaaaaacaccatttatgttaactg |
5754419 |
T |
 |
| Q |
224 |
tgnnnnnnnctgaccgtgnnnnnnncattcttttctaaatcaaatggatctcttcatct |
282 |
Q |
| |
|
|| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5754418 |
tgtttttttctgaccgtgtttttttcattcttttctaaatcaaatggatctcttcatct |
5754360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University