View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_high_45 (Length: 275)
Name: NF0684_high_45
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_high_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 165 - 269
Target Start/End: Complemental strand, 36707268 - 36707164
Alignment:
| Q |
165 |
ttagagcaataagtatacccaacgtttatttgcttgaacaacttgttttacagcatcaatgtactgctcaacagaaggtgatggcatcagcagcctctct |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36707268 |
ttagagcaataagtatacccaacgtttatttgcatgaacaacttgttttacagcatcaatgtactgctcaacagaaggtgatggcatcagcagcctctct |
36707169 |
T |
 |
| Q |
265 |
gctcc |
269 |
Q |
| |
|
||||| |
|
|
| T |
36707168 |
gctcc |
36707164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 36707436 - 36707308
Alignment:
| Q |
1 |
aactcgaactcattagtgcatactccaacttactaacta----catgtttggtatcacaatgtattttgtctgaaccatagtgactcattatgattctga |
96 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
36707436 |
aactcgaactcattagtgcatactcgaacttactaactagctacatgtttggtatcacaatgaattttgtctgaaccatagtcacttattatgattctga |
36707337 |
T |
 |
| Q |
97 |
caaatacatcgtaataccagacatgcact |
125 |
Q |
| |
|
|||||||||||||||| |||||||||||| |
|
|
| T |
36707336 |
caaatacatcgtaatatcagacatgcact |
36707308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University