View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_high_48 (Length: 259)
Name: NF0684_high_48
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_high_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 31 - 248
Target Start/End: Complemental strand, 29042035 - 29041824
Alignment:
| Q |
31 |
tggaatcttaaagggtaccctgacttgctgatgaatgtcaaaactttgattcaacatggaccttgttttgtttgggaaactaaaggtcagtagtactagt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29042035 |
tggaatcttaaagggtaccctgacttgccgatgaatgtcaaaactttgattcaacatggaccttgttttgtttgggaaactaaaggtcagt------agt |
29041942 |
T |
 |
| Q |
131 |
agatgccaagatttctgaagcacacaatcgcagttctgacagccatagttgaatagcatgtcaatcagatggattctgaagttacttctattgtaaattt |
230 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| | ||||| |||||||||||||||||||||| ||| ||||||| |
|
|
| T |
29041941 |
agatgccaagatttctgaagtacacaatcgcagttctgacggccatagttgaatagcctttcaatgagatggattctgaagttacttccattataaattt |
29041842 |
T |
 |
| Q |
231 |
gttggatgatattgtgac |
248 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
29041841 |
gttggatgagattgtgac |
29041824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University