View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_high_49 (Length: 259)
Name: NF0684_high_49
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0684_high_49 |
 |  |
|
[»] scaffold0172 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0172 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: scaffold0172
Description:
Target: scaffold0172; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 39 - 229
Target Start/End: Complemental strand, 28183 - 27993
Alignment:
Q |
39 |
attcagattcttgattcgtccattaagactaggggaaaagttaggttgattcaatgagaaattgagagctgatcttacctcatataagtgaggatgtttt |
138 |
Q |
|
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28183 |
attcagattctcgattcgtccattaagaccaggggaaaagttaggttgattcaatgagaaattgagagctgatcttacctcatataagtgaggatgtttt |
28084 |
T |
 |
Q |
139 |
tcctaatgggaggaagaaaggccgactaagaccacatgtaagaaagcctaacctccttgaagattacggtcaaggataatggggagatgat |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28083 |
tcctaatgggaggaagaaaggccgactaagaccacatgtaagaaagcctaacctccttgaagattacggtcaaggataatggggagatgat |
27993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1791 times since January 2019
Visitors: 4432