View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0684_high_49 (Length: 259)

Name: NF0684_high_49
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0684_high_49
NF0684_high_49
[»] scaffold0172 (1 HSPs)
scaffold0172 (39-229)||(27993-28183)


Alignment Details
Target: scaffold0172 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: scaffold0172
Description:

Target: scaffold0172; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 39 - 229
Target Start/End: Complemental strand, 28183 - 27993
Alignment:
39 attcagattcttgattcgtccattaagactaggggaaaagttaggttgattcaatgagaaattgagagctgatcttacctcatataagtgaggatgtttt 138  Q
    ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28183 attcagattctcgattcgtccattaagaccaggggaaaagttaggttgattcaatgagaaattgagagctgatcttacctcatataagtgaggatgtttt 28084  T
139 tcctaatgggaggaagaaaggccgactaagaccacatgtaagaaagcctaacctccttgaagattacggtcaaggataatggggagatgat 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28083 tcctaatgggaggaagaaaggccgactaagaccacatgtaagaaagcctaacctccttgaagattacggtcaaggataatggggagatgat 27993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University