View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_high_5 (Length: 475)
Name: NF0684_high_5
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_high_5 |
 | |
|
| [»] scaffold0189 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0189 (Bit Score: 352; Significance: 0; HSPs: 2)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 124 - 475
Target Start/End: Original strand, 14092 - 14443
Alignment:
| Q |
124 |
gtagatggattatatcgatttattattcagttctagtgaacaatattttaagtcatttgtgtatcctttattggatgaaactcgagcacaactatgttct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14092 |
gtagatggattatatcgatttattattcagttctagtgaacaatattttaagtcatttgtgtatcctttattggatgaaactcgagcacaactatgttct |
14191 |
T |
|
| Q |
224 |
tccatggaaattttgtcaacttcaccttatgcagaagtgatttcacttgaggagtcaagatcacattcatatggtaggaatcactacgtcgttaaaactg |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14192 |
tccatggaaattttgtcaacttcaccttatgcagaagtgatttcacttgaggagtcaagatcacattcatatggtaggaatcactacgtcgttaaaactg |
14291 |
T |
|
| Q |
324 |
atacttggaaaaacaggtcctctggtcatggaaaagagttatacaaaacattgtttggcgatgtttttattttggcagattttaaacctgaaacggttaa |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14292 |
atacttggaaaaacaggtcctctggtcatggaaaagagttatacaaaacattgtttggcgatgtttttattttggcagattttaaacctgaaacggttaa |
14391 |
T |
|
| Q |
424 |
tgatttgcaaaggtcaggaagaacgtggagttttgtgttgtcggctggtttt |
475 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14392 |
tgatttgcaaaggtcaggaagaacgtggagttttgtgttgtcggctggtttt |
14443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 28 - 76
Target Start/End: Original strand, 13997 - 14045
Alignment:
| Q |
28 |
caaaaacaaggttttgaaaacttctttctcttactctatcacattatca |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13997 |
caaaaacaaggttttgaaaacttctttctcttactctatcacattatca |
14045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 394 times since January 2019
Visitors: 4381