View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0684_high_65 (Length: 222)

Name: NF0684_high_65
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0684_high_65
NF0684_high_65
[»] chr8 (2 HSPs)
chr8 (164-222)||(12393489-12393547)
chr8 (72-132)||(12393578-12393638)


Alignment Details
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 164 - 222
Target Start/End: Complemental strand, 12393547 - 12393489
Alignment:
164 ctcaataaaatctctctttttctttcttgtttcttcaaaaccagcttgaaaaggaaaca 222  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
12393547 ctcaataaaatctctctttttctttcttgtttcttcaaaaccaacttgaaaaggaaaca 12393489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 72 - 132
Target Start/End: Complemental strand, 12393638 - 12393578
Alignment:
72 tctccaataatatgtgcattcacggcttcgtttagattgcctccatattcctgcacagtgc 132  Q
    ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
12393638 tctccgataaaatgtgcattcacggcttcgtttagattgcctccatattcctgcacagtgc 12393578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1595 times since January 2019
Visitors: 4425