View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_high_68 (Length: 215)
Name: NF0684_high_68
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_high_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 47196786 - 47196661
Alignment:
| Q |
1 |
ttactaagtttttgtacgtaataatcaaaattagttcatttccttctctctgtactattttttgtttctgtttatttttcctatatgccaaacttagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47196786 |
ttactaagtttttgtacgtaataatcaaaattagttcatttccttctctctgtactattttttgtttctgtttatttttcctatatgccaaacttagaga |
47196687 |
T |
 |
| Q |
101 |
tcaacacgaactgttatttgatgatg |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47196686 |
tcaacacgaactgttatttgatgatg |
47196661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University