View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0684_high_71 (Length: 208)

Name: NF0684_high_71
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0684_high_71
NF0684_high_71
[»] chr5 (1 HSPs)
chr5 (4-118)||(38713515-38713629)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 4 - 118
Target Start/End: Complemental strand, 38713629 - 38713515
Alignment:
4 tttttgtcaagtctccaatctttaccatgcatgttatatatcttgattatctggataacactcgaaaatctcaattatggcattatcaaagaaaaatgtt 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38713629 tttttgtcaagtctccaatctttaccatgcatgttatatatcttgattatctggataacactcgaaaatctcaattatggcattatcaaagaaaaatgtt 38713530  T
104 tatatcatgatgatg 118  Q
    |||||||||||||||    
38713529 tatatcatgatgatg 38713515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University