View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_high_71 (Length: 208)
Name: NF0684_high_71
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0684_high_71 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 4 - 118
Target Start/End: Complemental strand, 38713629 - 38713515
Alignment:
Q |
4 |
tttttgtcaagtctccaatctttaccatgcatgttatatatcttgattatctggataacactcgaaaatctcaattatggcattatcaaagaaaaatgtt |
103 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38713629 |
tttttgtcaagtctccaatctttaccatgcatgttatatatcttgattatctggataacactcgaaaatctcaattatggcattatcaaagaaaaatgtt |
38713530 |
T |
 |
Q |
104 |
tatatcatgatgatg |
118 |
Q |
|
|
||||||||||||||| |
|
|
T |
38713529 |
tatatcatgatgatg |
38713515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University