View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0684_low_115 (Length: 232)

Name: NF0684_low_115
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0684_low_115
NF0684_low_115
[»] chr8 (1 HSPs)
chr8 (28-101)||(20168662-20168735)
[»] chr7 (1 HSPs)
chr7 (28-101)||(44390371-44390444)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 101
Target Start/End: Complemental strand, 20168735 - 20168662
Alignment:
28 taatcctttagagactaattcatggtattcttcttcctcacatgaactccatcgtgatccctcgtgttcatctc 101  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||    
20168735 taatcctttagagactgattcatggtattcttcttcctcacatgaactccatcgtgacccctcatgttcctctc 20168662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 101
Target Start/End: Complemental strand, 44390444 - 44390371
Alignment:
28 taatcctttagagactaattcatggtattcttcttcctcacatgaactccatcgtgatccctcgtgttcatctc 101  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||    
44390444 taatcctttagagactgattcatggtattcttcttcctcacatgaactccatcgtgacccctcatgttcctctc 44390371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University