View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_115 (Length: 232)
Name: NF0684_low_115
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_115 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 101
Target Start/End: Complemental strand, 20168735 - 20168662
Alignment:
| Q |
28 |
taatcctttagagactaattcatggtattcttcttcctcacatgaactccatcgtgatccctcgtgttcatctc |
101 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||| |
|
|
| T |
20168735 |
taatcctttagagactgattcatggtattcttcttcctcacatgaactccatcgtgacccctcatgttcctctc |
20168662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 101
Target Start/End: Complemental strand, 44390444 - 44390371
Alignment:
| Q |
28 |
taatcctttagagactaattcatggtattcttcttcctcacatgaactccatcgtgatccctcgtgttcatctc |
101 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||| |
|
|
| T |
44390444 |
taatcctttagagactgattcatggtattcttcttcctcacatgaactccatcgtgacccctcatgttcctctc |
44390371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University