View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_120 (Length: 222)
Name: NF0684_low_120
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_120 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 164 - 222
Target Start/End: Complemental strand, 12393547 - 12393489
Alignment:
| Q |
164 |
ctcaataaaatctctctttttctttcttgtttcttcaaaaccagcttgaaaaggaaaca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12393547 |
ctcaataaaatctctctttttctttcttgtttcttcaaaaccaacttgaaaaggaaaca |
12393489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 80 - 132
Target Start/End: Complemental strand, 12393630 - 12393578
Alignment:
| Q |
80 |
aaaatgtgcattcacggcttcgtttagattgcctccatattcctgcacagtgc |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12393630 |
aaaatgtgcattcacggcttcgtttagattgcctccatattcctgcacagtgc |
12393578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1228 times since January 2019
Visitors: 4413