View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_124 (Length: 210)
Name: NF0684_low_124
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_124 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 32254227 - 32254049
Alignment:
| Q |
19 |
atctgtggaaaaatatgaagaaattaagtaatgtttataacatttgtgaactatatacgtatcatagaattttggcttacgaactaaaagatccgcttgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
32254227 |
atctgtggaaaaatatgaagaaattaagtaatgtttataacatttgtgaactatatacgtatcatagaattttgacttacgaactaaaagatccgctcgc |
32254128 |
T |
|
| Q |
119 |
catttcccagtaatgatctcaacaaaagacttgaatttcaatccaacattac---tatcatgatgattgacatcaatag |
194 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32254127 |
catttcccagtaatgatctcggcaaaagacttgaatttcaatccaacattactgatatcatgatgattgacatcaatag |
32254049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1632 times since January 2019
Visitors: 4426