View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_130 (Length: 204)
Name: NF0684_low_130
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0684_low_130 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 31322893 - 31322800
Alignment:
Q |
1 |
ttataagcttcaaattcaaataattgtaaacggtttatactcttaagtagttatcgaagatatatttcaacatataagttttttcattttgtta |
94 |
Q |
|
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
31322893 |
ttataagctttatattcaaataattgtaaacggtttatactcttaagtagttatcgaagatatatttcaacatataagttgtttcattttgtta |
31322800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1586 times since January 2019
Visitors: 4425