View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_133 (Length: 201)
Name: NF0684_low_133
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_133 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 9e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 21 - 168
Target Start/End: Complemental strand, 33581154 - 33581007
Alignment:
| Q |
21 |
actcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcagtctccgccttagaatgtggatatgcctgtgctgctgaagtacactaccc |
120 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33581154 |
actcacagcttgcaaaggctttgtcaattgaaggagactaccgaggttaagtctccgccttagaatgtggatatgcctgtgctgctgaagtacactaccc |
33581055 |
T |
|
| Q |
121 |
agatttgcaggttagttttgaaaggttacaagaaaagacatctccttt |
168 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33581054 |
agatttgcaggttagttttgaaaggtttcaagaaaagacatctccttt |
33581007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 21 - 168
Target Start/End: Complemental strand, 32356462 - 32356315
Alignment:
| Q |
21 |
actcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcagtctccgccttagaatgtggatatgcctgtgctgctgaagtacactaccc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
32356462 |
actcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcaatctccgccttagaatgtggatatgcctgtgctactgaagtacgctaccc |
32356363 |
T |
|
| Q |
121 |
agatttgcaggttagttttgaaaggttacaagaaaagacatctccttt |
168 |
Q |
| |
|
||| |||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
32356362 |
agagttgcaggttagtagtgaaaggctacaagaaaagacatctccttt |
32356315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 21 - 137
Target Start/End: Complemental strand, 17922397 - 17922281
Alignment:
| Q |
21 |
actcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcagtctccgccttagaatgtggatatgcctgtgctgctgaagtacactaccc |
120 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||| ||||| ||||||||| ||||||| | |||||| |||||| |
|
|
| T |
17922397 |
actcacagcttgcaaatgctctgtcaactgaaggagactaccggggttcagtctcggccatagaacgtggatatgtctgtgctagtaaagtaccctaccc |
17922298 |
T |
|
| Q |
121 |
agatttgcaggttagtt |
137 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
17922297 |
agagatgcaggttagtt |
17922281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 50 - 137
Target Start/End: Complemental strand, 8024690 - 8024603
Alignment:
| Q |
50 |
gaaggagactaccggggttcagtctccgccttagaatgtggatatgcctgtgctgctgaagtacactacccagatttgcaggttagtt |
137 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||| ||||||||| ||||||| || |||||| ||||||||| ||||||||||||| |
|
|
| T |
8024690 |
gaaggagactaccagggttcagtctcggccttagaacgtggatatgtctgtgctactaaagtaccctacccagagttgcaggttagtt |
8024603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1445 times since January 2019
Visitors: 4416