View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_19 (Length: 449)
Name: NF0684_low_19
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0684_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 94 - 442
Target Start/End: Original strand, 3420630 - 3420978
Alignment:
Q |
94 |
acgtaactcataatctccgagtaacggctcgtcggccgagcaatttcaaattgtacggcgaaatcaagctccacgaagtacctattctgccacgtggacg |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3420630 |
acgtaactcataatctccgagtaacggctcgtcggccgagcaatttcaaattgtacggcgaaatcaagctccacgaagtacctattctgccacgtggacg |
3420729 |
T |
 |
Q |
194 |
atccagatcgcattcgcaccacatcaataaactcgtggttcccagcggtgagtccaccggaggaatcccaccgcgtcttgcaaatcgccgcattgtgtcc |
293 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3420730 |
atccagatcgcattcgcaccacatcaataaactcgtggttcccagcggtgagtccaccggaggaatcccaccgcgtcttgcaaatcgccgcattgtgtcc |
3420829 |
T |
 |
Q |
294 |
tttctcacgcaaaaatgacatcacgttacggttataaaccgaaatgctttgtttcttcagaaaatcgaatttcaccgcagcttcagaaacatgcaatcga |
393 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3420830 |
tttctcacgcaaaaatgacatcacgttacggttataaaccgaaacgctttgtttcttcagaaaatcgaatttcaccgcagcttcagaaacatgcaatcga |
3420929 |
T |
 |
Q |
394 |
agcatgttcaggtaagaatctgcattagcattttcagcacttcatctca |
442 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
3420930 |
agcatgttcaggtaagaatctgcattagcattttcagcacttaatctca |
3420978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1088 times since January 2019
Visitors: 4402