View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_21 (Length: 445)
Name: NF0684_low_21
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 81 - 439
Target Start/End: Complemental strand, 40645597 - 40645239
Alignment:
| Q |
81 |
catcatcaagtctatctcaatatcaatatcaaacatttatagtctcttacccacttcaacgcagttaggagtcttattgcttcacctgtatactctttga |
180 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40645597 |
catcttcaagtctatctcaatatcaatatcaaacatttatagtcttttacccacttcaacgcagttaggagtcttattgcttcacctgtatactctttga |
40645498 |
T |
|
| Q |
181 |
gaataggggatacccacttagttcttgctagggcaatgctcctttgattgtctctaatgaaaatacagatgctactttattaagcgcattggagaacgat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40645497 |
gaataggggatacccacttagttcttgctagggcaatgctcctttgatcgtctctaatgaaaatacaaatgctactttattaagcgcattggagaacgat |
40645398 |
T |
|
| Q |
281 |
gcatctacattacacttgtatcgctcgtggatggtttaatccaattcaacttgttatagaagtgagtggttcttgaattctacgcttagcatcttgagca |
380 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40645397 |
gcatctacattacactcgtatcgctcgtggatggtttaacccaattcgatttgttgtagaagtgagtggttcttgaattctacgcttagcatcttgagca |
40645298 |
T |
|
| Q |
381 |
tttagccagcttgacaagtatcattgacatcattccaaattttattgttcctatgcttc |
439 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40645297 |
tttagccagcttgacaagtatcattgacatcattccaaattttattgttcctatgcttc |
40645239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1597 times since January 2019
Visitors: 4425