View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_24 (Length: 437)
Name: NF0684_low_24
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 30 - 424
Target Start/End: Complemental strand, 12215383 - 12214987
Alignment:
| Q |
30 |
tctacatcttgcatatattttttgtct----cgaatgccaatttcttgactcacatgccgactgtgggggcgctctacacccgacataatggtagatttg |
125 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12215383 |
tctacatcttgcatatattttttgtcttagtcgaatgccaatttcttgactcacatgccgactgtgggggcgctctacacccgacataatggtagatttg |
12215284 |
T |
|
| Q |
126 |
gttaagagattgttgttgcgatgttagatatggctatttgtaatgaattttggttcgaattttggcgctccacttcttgttgttcgttggtgatgcatca |
225 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12215283 |
gttaagagactgttgtttcgatgttagatatggctatttgtaatgaattttggtttgaattttggcgctccacttcttgtt---cgttggtgatgcatca |
12215187 |
T |
|
| Q |
226 |
atcagacaaccatgctatgttggtttcttcgatgttttcccctcttccgcatgcaactagtttcaaatttttcaaaacttggttgatgcaagcgtctagt |
325 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12215186 |
atcaaacaaccatgctatgttggtttcttcgatgttttcccctcttccgcatgcaactagtttcaaatttttcaaaacttggttgatgcaagcgtctagt |
12215087 |
T |
|
| Q |
326 |
ttcggctacttggggtaaggtttgtgttggcagttgtatgtctagtcttcagcaaaagcttaagaggttgaa-caggtttttcaggtttggaataggtct |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
12215086 |
ttcggctacttggggtaaggtttgtgttggcagttgtatgtctagtcttcaggaaaagcttaagaggttgaagcaggtttttcgggtctggaataggtct |
12214987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 434 times since January 2019
Visitors: 4381