View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_29 (Length: 399)
Name: NF0684_low_29
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0684_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 4e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 275 - 385
Target Start/End: Original strand, 31322816 - 31322926
Alignment:
Q |
275 |
cttatatgttgaaatatatcttcgataactacttaagagtataaaccgtttacaattatttgaatttgaagcttataaaagaactggtctatttctactt |
374 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
T |
31322816 |
cttatatgttgaaatatatcttcgataactacttaagagtataaaccgtttacaattatttgaatataaagcttataaaagaactggtctatttctactt |
31322915 |
T |
 |
Q |
375 |
tgattagtata |
385 |
Q |
|
|
||||||||||| |
|
|
T |
31322916 |
tgattagtata |
31322926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University