View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0684_low_29 (Length: 399)

Name: NF0684_low_29
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0684_low_29
NF0684_low_29
[»] chr1 (1 HSPs)
chr1 (275-385)||(31322816-31322926)


Alignment Details
Target: chr1 (Bit Score: 103; Significance: 4e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 275 - 385
Target Start/End: Original strand, 31322816 - 31322926
Alignment:
275 cttatatgttgaaatatatcttcgataactacttaagagtataaaccgtttacaattatttgaatttgaagcttataaaagaactggtctatttctactt 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||    
31322816 cttatatgttgaaatatatcttcgataactacttaagagtataaaccgtttacaattatttgaatataaagcttataaaagaactggtctatttctactt 31322915  T
375 tgattagtata 385  Q
    |||||||||||    
31322916 tgattagtata 31322926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 866 times since January 2019
Visitors: 4397