View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_34 (Length: 393)
Name: NF0684_low_34
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 11 - 297
Target Start/End: Original strand, 33699860 - 33700141
Alignment:
| Q |
11 |
cataggcaattattgtatatataaattaatgaaatagtggtaacgccttggagcgatgtgtgtcctgccagtggcaacatcgatgaagaaaatgatgcaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33699860 |
cataggcaattattgtatatataaattaatgaaatagtggtaacgccttggagcgatgtgtgtcctgccagtggcaacatcgatgaagaaaatgatgcaa |
33699959 |
T |
 |
| Q |
111 |
ggaaggtagttagaacaatcatattcataagttcaatcattctaggagttttgtactctcttcagtatcggaaaataagctatagaaatatatactctcg |
210 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33699960 |
g-----tagttagaacaatcatattcataagttcaatcattctaggagttttgtactctcttcagtatcggaaaataagctatagaaatatatactctcg |
33700054 |
T |
 |
| Q |
211 |
tcagatataatattnnnnnnnctttttaaaacatgcattttttcaaatatatgttcttagtaatttgaattgtgtagggattgaaga |
297 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33700055 |
tcagatatagtattaaaaaaactttttaaaacatgcattttttcaaatatatgttcttagtaatttgaattgtgtatggattgaaga |
33700141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University