View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0684_low_48 (Length: 352)

Name: NF0684_low_48
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0684_low_48
NF0684_low_48
[»] chr3 (1 HSPs)
chr3 (1-230)||(17025044-17025267)


Alignment Details
Target: chr3 (Bit Score: 136; Significance: 7e-71; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 17025267 - 17025044
Alignment:
1 caagtcttttatttcaaactttgttggtaggttgcttttagtttctccatttctattacattatctctaataaaaactatatcatttattggtcaatatt 100  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||||||||||     
17025267 caagtctttgatttcaaactttgttggtaggttgcttttagtttctccatttctattacattatcactaataagaactataccatttattggtcaatat- 17025169  T
101 aaagaaagatacaacgataacaaaggcgctgggggttaatagcttttcccctacnnnnnnnnnngtgaaaagtggatttaaaattcttatgaaaagttat 200  Q
       ||||||||||||||||||| ||| | ||||||||||||||||||||||||           |||||||||||||||||||||||| |||||||||||    
17025168 ---gaaagatacaacgataacatagggggtgggggttaatagcttttccccta---aaaaaaatgtgaaaagtggatttaaaattcttttgaaaagttat 17025075  T
201 tgat-ggattttgtgcgacgaatgtcaatga 230  Q
    |||| ||||||||||||||||||||||||||    
17025074 tgatgggattttgtgcgacgaatgtcaatga 17025044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University