View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_48 (Length: 352)
Name: NF0684_low_48
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 7e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 17025267 - 17025044
Alignment:
| Q |
1 |
caagtcttttatttcaaactttgttggtaggttgcttttagtttctccatttctattacattatctctaataaaaactatatcatttattggtcaatatt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
17025267 |
caagtctttgatttcaaactttgttggtaggttgcttttagtttctccatttctattacattatcactaataagaactataccatttattggtcaatat- |
17025169 |
T |
 |
| Q |
101 |
aaagaaagatacaacgataacaaaggcgctgggggttaatagcttttcccctacnnnnnnnnnngtgaaaagtggatttaaaattcttatgaaaagttat |
200 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17025168 |
---gaaagatacaacgataacatagggggtgggggttaatagcttttccccta---aaaaaaatgtgaaaagtggatttaaaattcttttgaaaagttat |
17025075 |
T |
 |
| Q |
201 |
tgat-ggattttgtgcgacgaatgtcaatga |
230 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
17025074 |
tgatgggattttgtgcgacgaatgtcaatga |
17025044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University