View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_50 (Length: 347)
Name: NF0684_low_50
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0684_low_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 10028948 - 10028744
Alignment:
Q |
1 |
agttgaagaggctttaagaaaatggcgatccgatggtaacaaaaggcgatcatcaaactctacaaagtttaaaaacccttctcactatcggagaggcttt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||| | |
|
|
T |
10028948 |
agttgaagaggctttaagaaaatggcgatccgagggtaacaaaaggcgatcatcatactctacaaagtttaaaaacccttctcactatcgaagaagctct |
10028849 |
T |
 |
Q |
101 |
cggac---cgacataaatgggatgaatcaagttgatgatgaagccaaaccaattctaaagccgactctatcgataggtcaaatattgagccggaaactga |
197 |
Q |
|
|
||| |||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10028848 |
cggttattcgacgtaaatgggacgaatcaagttgatgatgaagccaaaccagttctaaagccgactctatcgataggtcaaatattgagccggaaactga |
10028749 |
T |
 |
Q |
198 |
tgatg |
202 |
Q |
|
|
||||| |
|
|
T |
10028748 |
tgatg |
10028744 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University