View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_52 (Length: 336)
Name: NF0684_low_52
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 30 - 327
Target Start/End: Original strand, 27319729 - 27320026
Alignment:
| Q |
30 |
ccactggcatagatgctgttgttttgtatagtcccagaatcttcgagaaggctgggatcaaatccgacacaaataagcttctcgcaactgtagctgttgg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27319729 |
ccactggcatagatgctgttgttttgtatagtcccagaatcttcgagaaggctgggatcaaatccgacacaaataagcttctcgcaactgtagctgttgg |
27319828 |
T |
|
| Q |
130 |
atttgtgaaaacaatgttcgtcttagtggccacttttttattagaccgcgttgggaggcgcgtattgttgttaaccagtgtaggtgggttaataatctcg |
229 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27319829 |
atttgtgaaaacaatgttcgtcttagttgccacttttttattagaccgcgttgggaggcgcgtattgttgttaaccagtgtaggtgggttaataatctcg |
27319928 |
T |
|
| Q |
230 |
cttctgactttggcgattagtctcactattattgataattcaagtgccacgctgacatgggctatttcacttagtatagcagcagtgttgtcctatgc |
327 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27319929 |
cttctgacattggcgattagtctcactattattgataattcaagtgccacgctgacatgggctatttcacttagtatagcagcagtgttgtcctatgc |
27320026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1525 times since January 2019
Visitors: 4422