View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_53 (Length: 332)
Name: NF0684_low_53
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 43 - 322
Target Start/End: Original strand, 42241029 - 42241308
Alignment:
| Q |
43 |
gaaacacaatattgttgaaggttgcctctttttagaacgctttgtattttataattaatcaaacaagtaacaagaagtccaattgaaagtattcctggac |
142 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42241029 |
gaaacaaaatattgttgaaggttgcctctttttagaacgctttgtattttataattaatcaaacaagtaacaagaagtccaattgaaagtattccttgac |
42241128 |
T |
|
| Q |
143 |
aaacctttgaaagtttatgctgtagtgcatatattgttcttgactacaccaagaagtaaatctttccggcattttctatctcaacggtgtagaaacttaa |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42241129 |
aaacctttgaaagtttatgctgtagtgcatatattgttcttgactacaccaagaagtaaatctttccggcattttctatctcaacggtgtagaaacttaa |
42241228 |
T |
|
| Q |
243 |
ttttgtcaaggacaaaccttttacaagttttgtctctgacagtctaagacagaagttgttcttaactatgaatctctctg |
322 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42241229 |
ttttgtcaaggacagaccttttacaagttttgtctctgacaatctaagacagaagttgttcttaactatgaatctctctg |
42241308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1558 times since January 2019
Visitors: 4422