View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_54 (Length: 328)
Name: NF0684_low_54
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 29 - 325
Target Start/End: Complemental strand, 39070368 - 39070075
Alignment:
| Q |
29 |
agatgttttatca--tatgacttctctagaaatcatgtgctttggatgcatgcatatgataattgaaacttgaaagcatgaattaaataaaaaaggaaga |
126 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39070368 |
agatgttttatcacatatgacttctctagaaatcatgtgctttggatgcatgcatatgataattgaaacttgaaagcatgaattaaataaaaa-ggaaga |
39070270 |
T |
|
| Q |
127 |
aattgctatagtattgattcaaatgattataatgaggtcgttcgtatatcaccgtacattaggacattcacatctccacaatgagttttgtcaaaatgtg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39070269 |
aattgctatagtattgattcaaatgattataatgaggtcgt----atatcaccgtacattaggacattcacatctccacaatgagttttgtcaaaatgtg |
39070174 |
T |
|
| Q |
227 |
catgtgattgttgcattatttgatttggattaagataacgcattttgcttatcataagcacaccatgtgcacaactagctacctttcctatgatactac |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
39070173 |
catgtgattgttgcattatttgatttggattaagataacgcattttgcttatcataagcacaccatgtgcacaactagctacctttcccatgatgctac |
39070075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1263 times since January 2019
Visitors: 4413