View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_58 (Length: 323)
Name: NF0684_low_58
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0684_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 122 - 318
Target Start/End: Original strand, 45671407 - 45671603
Alignment:
Q |
122 |
actaaccttgatactaactgagtaaagaaccatatcatcgaccgtggtaacattaagatgaagaatggtaagcctaagattttgtaacccaacaacaatc |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45671407 |
actaaccttgatactaactgagtaaagaaccatatcatcgaccgtggtaacattaagatgaagaatggtaagcctaagattttgtaacccaacaacaatc |
45671506 |
T |
 |
Q |
222 |
ttcataagttgtcctggttttttcttggatagaattttcatgttggcatgactatctaccattgtaacttcaatgtctgcaacagccctttgcttct |
318 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
T |
45671507 |
ttcataagttgtcctggttttttcttggatagaattttcatgttggcatgactatctaccattgtaacttcaatgtctgcaacagcccattgtttct |
45671603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1304 times since January 2019
Visitors: 4413