View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0684_low_60 (Length: 317)

Name: NF0684_low_60
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0684_low_60
NF0684_low_60
[»] chr1 (1 HSPs)
chr1 (152-222)||(884129-884199)


Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 152 - 222
Target Start/End: Original strand, 884129 - 884199
Alignment:
152 aatttcgacatcacatattctcaaagtaaggcttataattaaatccatgaattaaggacaccaccaaagga 222  Q
    |||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
884129 aatttcaacatcacatattctcaaagtaaggcttataattaaatccacgaattaaggacaccaccaaagga 884199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University