View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_63 (Length: 309)
Name: NF0684_low_63
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 71 - 205
Target Start/End: Complemental strand, 32237825 - 32237693
Alignment:
| Q |
71 |
atgttatcttattatttgtcattcctctgacataattaannnnnnnn-gggcaggggaagttgcacattttggagcagggtatacttttcattctcatat |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32237825 |
atgttatcttattatttgtcattcctctgacataattaatttttttttgggcaggggaagttgcacattttggagcagggtatacttttcattctcatat |
32237726 |
T |
 |
| Q |
170 |
aaatgatcttaatcatattatttgttttaaattgat |
205 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| |
|
|
| T |
32237725 |
aaatgat-ttaatcatatta--tgttttaaattgat |
32237693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University