View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0684_low_63 (Length: 309)

Name: NF0684_low_63
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0684_low_63
NF0684_low_63
[»] chr6 (1 HSPs)
chr6 (71-205)||(32237693-32237825)


Alignment Details
Target: chr6 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 71 - 205
Target Start/End: Complemental strand, 32237825 - 32237693
Alignment:
71 atgttatcttattatttgtcattcctctgacataattaannnnnnnn-gggcaggggaagttgcacattttggagcagggtatacttttcattctcatat 169  Q
    |||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||||||||||||||    
32237825 atgttatcttattatttgtcattcctctgacataattaatttttttttgggcaggggaagttgcacattttggagcagggtatacttttcattctcatat 32237726  T
170 aaatgatcttaatcatattatttgttttaaattgat 205  Q
    ||||||| ||||||||||||  ||||||||||||||    
32237725 aaatgat-ttaatcatatta--tgttttaaattgat 32237693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1171 times since January 2019
Visitors: 4407