View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_66 (Length: 307)
Name: NF0684_low_66
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_66 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 86 - 242
Target Start/End: Original strand, 1948982 - 1949147
Alignment:
| Q |
86 |
acaaaattataatcttcaccatc---tttccattacaaccgcttttaacacatcacatccaatcattattaaccggtttcatctttgcc------aatta |
176 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
1948982 |
acaaaattataatcttcaccatcatctttccattacaacctcctttaacacatcacatccaatcattattaaccggtttcatctttgccatttttatttt |
1949081 |
T |
|
| Q |
177 |
nnnnnnngtaatttaatcatattttagcctttcatcttctttgcataacctctcacaatattcttc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1949082 |
tatttttgtaatttaatcatattttagcctttcatcttctttgcataacctctcacaatattcttc |
1949147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 185 - 242
Target Start/End: Complemental strand, 33771356 - 33771298
Alignment:
| Q |
185 |
taatttaatcatattttagcctttcatcttctttgca-taacctctcacaatattcttc |
242 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| || ||||||||||| |||||| |
|
|
| T |
33771356 |
taatttaatcatatttttgcttttcatcttctttgcattatcctctcacaattttcttc |
33771298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1744 times since January 2019
Visitors: 4429