View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_80 (Length: 285)
Name: NF0684_low_80
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_80 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 32254648 - 32254924
Alignment:
| Q |
1 |
tctaatgtgaaatataatgttaacatttttctagcataacatttattcttttccccttagcttgcctaaggatggacaacttatgtcccagagtccgttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32254648 |
tctaatgtgaaatataatgttaacatttttctaacacaacatttattcttttcctcttagcttgcctaaggatggacaacttatgtcccagagtacgttg |
32254747 |
T |
|
| Q |
101 |
gtctgtacacagtcacaatccagctcacagatccctaccgaagatgaactacttaaatctatcaataattgtcagcatattaggttcaaaattgaggggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| | |
|
|
| T |
32254748 |
gtctgtacacagtcacaatccagctcacagatccctaccgaagatgaactacttaaatctatcaataattgtctgcatattgggttcaaaattgaggtag |
32254847 |
T |
|
| Q |
201 |
aagtctcctatgaattcagcaaagcggcttttgttctttggggccgtgaggtcacacaattgttaggtatctctgct |
277 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||| ||||||||||||| | ||||||||||| |||||| |
|
|
| T |
32254848 |
aagtctcctatgaattcagcaaggcgggttttgttctttgggaccgtgaggtcacatagttgttaggtatttctgct |
32254924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 277
Target Start/End: Complemental strand, 22079740 - 22079692
Alignment:
| Q |
229 |
ttttgttctttggggccgtgaggtcacacaattgttaggtatctctgct |
277 |
Q |
| |
|
||||||| |||||| |||||||||||||||| ||||||| || |||||| |
|
|
| T |
22079740 |
ttttgttgtttgggaccgtgaggtcacacaaatgttagggatatctgct |
22079692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1646 times since January 2019
Visitors: 4426