View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_82 (Length: 282)
Name: NF0684_low_82
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_82 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 28 - 273
Target Start/End: Original strand, 36055961 - 36056206
Alignment:
| Q |
28 |
catcttaaacatccccaaaccccattgtcggacaaactttaataccaaattagcagcatgacgaatttaaattacacgaacaagtaaatacttgtgaatt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36055961 |
catcttaaacatccccaaaccccattgtcggacaaactttaataccaaattagcagcatgacgaatttaaattacacgaacaagtaaatccttgtgaatt |
36056060 |
T |
|
| Q |
128 |
tctacctttaagcccatatactagttcaagcagtagtataattgcctttgcaactcttacattgaaccctgaggtaccccctcttgagtatggtcggaag |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36056061 |
tctacctttaagcccatatactagttcaagcagtagtataattgcctttgcaactcttacattgaaccctgaggtaccccctcttgagtatggacggaag |
36056160 |
T |
|
| Q |
228 |
ggatagacattttggacaccgttttttacttaatagttagtattat |
273 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
36056161 |
ggatagacgttttggacaccaatttttacttaataaatagtattat |
36056206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1510 times since January 2019
Visitors: 4421