View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_83 (Length: 281)
Name: NF0684_low_83
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0684_low_83 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 43 - 236
Target Start/End: Original strand, 43091062 - 43091259
Alignment:
Q |
43 |
agaacctgtgacttggaaatttgaggttaagaaattttgaactgtggcgttgaaagcgtaaacagtgacatcttggagaataaaagacggtttagaaggt |
142 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
43091062 |
agaaactgtgacttggaaatttgaggttaagaaattttgaactgtggcgttgaaagcgtaaacagtgacatcttggagaatgaaagacggtttagaaggt |
43091161 |
T |
 |
Q |
143 |
tttaagacagcccaaatgattaggattgttactaggacgatgaagagggagattatgattcctagaagatttttctgaag----tgtgtttgtttcct |
236 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
43091162 |
tttaagacatcccaaatgattaggattgttactaggacgatgaagaggaagattatgattcctagaagatttttctgaagcgtttgtgtttgtttcct |
43091259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 43 - 222
Target Start/End: Original strand, 43076873 - 43077053
Alignment:
Q |
43 |
agaacctgtgacttggaaatttgaggttaagaaattttgaactgtggcgttgaaagcgtaaacagtgacatcttggagaataaaagacggtttagaaggt |
142 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
T |
43076873 |
agaaactgtgacttggaaatttgaggttaagaaatttggaactgtggcgttgaaagcgtaaacagtgacatcttggagaatgaaagaaggtttagaaggt |
43076972 |
T |
 |
Q |
143 |
tttaagacagcccaaatgattaggattgttactaggacgatgaagagggagattatgatt-cctagaagatttttctgaag |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| || ||||||||||||||||| |
|
|
T |
43076973 |
tttaagacagcccaaatgattaggattgttactaggacaatgaagaggaagattatgattccccagaagatttttctgaag |
43077053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 171 - 203
Target Start/End: Original strand, 43092104 - 43092136
Alignment:
Q |
171 |
ttactaggacgatgaagagggagattatgattc |
203 |
Q |
|
|
|||||||||||||||||||| |||||||||||| |
|
|
T |
43092104 |
ttactaggacgatgaagaggaagattatgattc |
43092136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 831 times since January 2019
Visitors: 4393