View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_90 (Length: 269)
Name: NF0684_low_90
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_90 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 57 - 124
Target Start/End: Original strand, 9334822 - 9334889
Alignment:
| Q |
57 |
gtattttgcactattttcttccatataatactgtttcttttattatatttctgtcagtctttcttacc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9334822 |
gtattttgcactattttcttccatataatactgtttcttttattatatttctgtcagtatttcttacc |
9334889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 70 - 128
Target Start/End: Original strand, 9358608 - 9358666
Alignment:
| Q |
70 |
ttttcttccatataatactgtttcttttattatatttctgtcagtctttcttaccgcat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9358608 |
ttttcttccatataatactgtttcttttattatatttctgtcagtatttcttaccgcat |
9358666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 215 - 269
Target Start/End: Complemental strand, 11575919 - 11575865
Alignment:
| Q |
215 |
ctttgtgatctattttcatatgatttttcaagtttcaaattcataatttcttatg |
269 |
Q |
| |
|
|||| |||| ||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
11575919 |
ctttctgatttattttcatatgatttttcaaatttcaaattcatgatttcttatg |
11575865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University